Review



dylight 649 conjugated tomato lectin vector laboratories cat  (Vector Laboratories)


Bioz Verified Symbol Vector Laboratories is a verified supplier
Bioz Manufacturer Symbol Vector Laboratories manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Vector Laboratories dylight 649 conjugated tomato lectin vector laboratories cat
    Dylight 649 Conjugated Tomato Lectin Vector Laboratories Cat, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 285 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dylight+649+conjugated+tomato+lectin+vector+laboratories+cat/DyLight+649+labeled+Lycopersicon+Esculentum+(Tomato)+Lectin+(LEL%2C+TL)/pm41529684-248-231-235
    Average 96 stars, based on 285 article reviews
    dylight 649 conjugated tomato lectin vector laboratories cat - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories CatDL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat#005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Plasmid Preparation:

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories CatDL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat#005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Control:

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories CatDL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat#005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Bioprocessing:

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories CatDL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat#005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Clinical Proteomics:

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories CatDL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat#005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS

    Recombinant:

    Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories CatDL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat#005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector Cat#H-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS



    Similar Products

    dylight 649 conjugated tomato lectin vector laboratories cat  (Vector Laboratories)
    96
    Vector Laboratories dylight 649 conjugated tomato lectin vector laboratories cat
    Dylight 649 Conjugated Tomato Lectin Vector Laboratories Cat, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/dylight+649+conjugated+tomato+lectin+vector+laboratories+cat/DyLight+649+labeled+Lycopersicon+Esculentum+(Tomato)+Lectin+(LEL%2C+TL)/pm41529684-248-231-235
    Average 96 stars, based on 1 article reviews
    dylight 649 conjugated tomato lectin vector laboratories cat - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results